Characterization of Extended-Spectrum-b-Lactamases Produced by Escherichia coli Strains Isolated From Dogs in Poland

pdf-icon-48x48MAGDALENA RZEWUSKA1*,, ILONA STEFAŃSKA2, MAGDALENA KIZERWETTER-ŚWIDA1, DOROTA CHROBAK-CHMIEL2, PAULINA SZCZYGIELSKA1, MONIKA LEŚNIAK3 and MARIAN BINEK1

1 Department of Preclinical Sciences, Faculty of Veterinary Medicine, Warsaw University of Life Sciences, Warsaw, Poland
2 Department of Fermentation Technology, Institute of Agricultural and Food Biotechnology, Warsaw, Poland
3 Department of Regenerative Medicine, Military Institute of Hygiene and Epidemiology, Warsaw, Poland

*Corresponding author. M. Rzewuska, Department of Preclinical Sciences, Faculty of Veterinary Medicine, Warsaw University of Life Sciences, Warsaw, Poland; e-mail: magdalena_rzewuska@sggw.pl.

Submitted 25 March 2015, accepted 8 April 2015

Abstract

Escherichia coli is a common cause of infections in companion animals. In recent years the increasing prevalence of resistance to β-lactams, including extended-spectrum cephalosporins, antimicrobials frequently used in small animal veterinary practice, was observed in canine isolates of E. coli. The aim of this study was to detect and to characterize extended-spectrum β-lactamases (ESBLs) produced by E. coli isolated from diseased dogs in Poland. Four isolates out of 119 studied (3.4%) were ESBL-positive. They harbored the blaSHV-12, blaCTX-M-15, and blaTEM-116 genes. This study provides the first report of the occurrence of ESBL-producing E. coli in dogs in Poland.

Key words: Escherichia coli, extended-spectrum β-lactamases, dog infections, multidrug resistance

Escherichia coli is an important opportunistic pathogen, causing in dogs mainly extraintestinal infections including those of urinary, respiratory and reproductive tracts. The antimicrobial resistance of E. coli occurring in companion animals, especially the multidrug resistance, becomes an emerging problem in veterinary medicine. The increasing percentage of multidrug resistant (MDR) E. coli isolation from dogs and cats in Poland, between 2007 and 2013, has been reported by Rzewuska et al. (2015). The increase in the prevalence of resistance to β-lactams, such as aminopenicillins and extended-spectrum cephalosporins, was also observed in canine E. coli isolates. The β-lactam resistance in Enterobacteriaceae is associated mainly with production of enzymes hydrolyzing these antibiotics, among which the extended-spectrum β-lactamases (ESBLs), plasmidic AmpC β-lactamases and carbapenemases are the most important resistance mechanisms (Rubin and Pitout, 2014). ESBLs mediate resistance to penicillins, cephalosporins and monobactams, but they are sensitive to β-lactam inhibitors. The presence of ESBL-producing E. coli in clinical specimens from dogs has been reported previously in some countries, such as the United States (O’Keefe et al., 2010; Shaheen et al., 2011), the Netherlands (Dierikx et al., 2012; Hordijk et al., 2013), Germany (Schmiedel et al., 2014), Italy (Carattoli et al., 2005) and Korea (So et al., 2012). However, detailed information about properties of ESBLs occurring in canine E. coli and their geographic distribution are still limited. To our knowledge, there are no published data regarding the occurrence of ESBLs in canine E. coli in Poland.

The aim of the study was to detect and to characterize ESBLs in E. coli isolated from diseased dogs in Poland. E. coli isolates (n = 119) investigated in this study were obtained from clinical samples collected from diseased dogs. The isolates were identified using standard microbiological diagnostic techniques. Antimicrobial susceptibility was determined by the disk diffusion method, as described previously (Rzewuska et al., 2015). E. coli ATCC 25922 was used as a quality control.

The phenotypic test using ceftazidime and ceftazidime/clavulanic acid disks (Becton Dickinson) was performed according to the Clinical and Laboratory Standards Institute guidelines (CLSI, 2013) to detect ESBLs production.

The presence of blaTEM, blaSHV, blaCTX-M-1 group and blaCTX-M-9 group genes was studied by PCR to determine the genotype of ESBL-positive isolates. In addition, those isolates were screened for the blaCMY-2 gene, as the activity of β-lactamase CMY-2 could mask the ESBL-positive phenotype (Thomson, 2010). The PCR assays were performed using primers (Genomed, Poland) and reaction conditions described previously (Table I). DNA was isolated using Genomic Mini kit (A&A Biotechnology, Poland) according to the manufacturer’s recommendations. In order to identify the type of genes detected, the obtained amplicons were purified with the GeneJETTM PCR Purification Kit (Thermo-Scientific) according to the manufacturer’s recommendations, and sequenced using the same primers and a 3730 xl DNA Analyzer (Applied Biosystems, USA). Sequencing files were evaluated using the Chromas Lite version 2.33 program (Technelysium Pty Ltd., Australia). Subsequently, the nucleotide sequences were compared to the sequences in the GenBank database using BLAST (http://blast.ncbi.nlm.nih.gov). Additionally, the blaTEM nucleotide sequences were translated into protein sequences, and then aligned with the reference sequence of TEM-1 β-lactamase (GenBank Accession Number J01749) by MEGA version 5.0. On the basis of the amino acid substitutions found and the TEM mutation table (http://www.lahey.org/Studies/temtable.asp), the type of TEM β-lactamase was determined for each blaTEM gene detected.

Table I
Primers used to detect genes encoding β-lactamases in the study
Target gene Primer sequence (5′-3′) Amplicon size (bp) Literature
blaTEM F- ATTCTTGAAGACGAAAGGGC 1150 Briñas et al., 2005
R- ACGCTCAGTGGAACGAAAAC
blaSHV F- CACTCAAGGATGTATTGTG 885 Briñas et al., 2005
R- TTAGCGTTGCCAGTGCTCG
blaCTX-M-1 group F- GTTACAATGTGTGAGAAGCAG 1049 Costa et al., 2008
R- CCGTTTCCGCTATTACAAAC
blaCTX-M-9 group F- GTGACAAAGAGAGTGCAACGG 857 Coque et al., 2002
R- ATGATTCTCGCCGCTGAAGCC
blaCMY-2 F- GATTCCTTGGACTCTTCAG 1807 Briñas et al., 2005
R- TAAAACCAGGTTCCCAGATAGC

In the present study all ESBL-producing E. coli isolates were classified as MDR bacteria, showing resistance to at least three antimicrobial classes (Table III). Multidrug resistance has been also observed in ESBL-positive E. coli of various origin in other studies (Schmiedel et al., 2014; Shaheen et al., 2011).ESBL-producing  E. coli was detected among the studied isolates, and this is the first report on the presence of this bacterium in dogs in Poland. The ESBL-positive phenotype was found in four E. coli isolates from extraintestinal infections in dogs. Characteristics of these isolates are presented in Table II. Genes of three different ESBLs were detected and identified, as blaSHV-12, blaCTX-M-15, and blaTEM-116. The fourth gene whose presence was assayed, blaCMY-2 encoding a plasmidic class C β-lactamase CMY-2, was not found in any of those isolates.

Table II
Characteristics of ESBLs produced by E. coli isolates obtained from dogs
Strain designation Clinical sample ESBL type
blaSHV blaTEM blaCTX
1062/09/D pharyngeal swab TEM-116 CTX-M-15
1370/06/D ear canal swab TEM-116 CTX-M-15
1945/06/D nasal swab SHV-12 TEM-116
2017/11/D soft tissue (liver) TEM-116 CTX-M-15

The occurrence of ESBL-producing E. coli in dogs, ranging from 1% to 33.3%, has been reported previously (Dierikx et al., 2012; Ewers et al., 2010; Hordijk et al., 2013; Huber et al., 2013; O’Keefe et al., 2010; Schmiedel et al., 2014; Shaheen et al., 2011; So et al., 2012). Ewers et al. (2010) reported that ESBL-producing E. coli was isolated from 10.7% of clinical samples collected from dogs. The high prevalence (33.3%) of these bacteria isolated from rectal swabs of hospitalized dogs in Korea was reported by So et al. (2012). In our study, only 3.4% (4/119 isolates) of studied E. coli isolates were ESBL-positive. These findings correspond with the observations of Shaheen et al. (2011) in the United States and Huber et al. (2013) in Switzerland, where the frequency of ESBL-producing E. coli isolation from dogs, mainly from urinary tract infections, was 3% and 3.3%, respectively.

Three different types of ESBLs were found in the studied E. coli isolates (Table II). The β-lactamase CTX-M-15, detected in three isolates, belongs to the CTX-M-1 group and represents the most frequently reported ESBL type in E. coli isolates of canine and feline origin (Ewers et al., 2010; Huber et al., 2013; O’Keefe et al., 2010; Schmiedel et al., 2014; Shaheen et al., 2011). The other ESBL, SHV-12, detected in one of the studied isolates, has rarely been found in E. coli isolated from dogs (Carattoli et al., 2005; Ewers et al., 2010; O’Keefe et al., 2010). Furthermore, in all ESBL-positive isolates the gene encoding the TEM-116 β-lactamase was detected. This enzyme is TEM-1 derivative with ESBL activity, and occurs in various species of Enterobacteriaceae isolated from humans (Dhara et al., 2013). This is only the second report of TEM-116 β-lactamase in E. coli of canine origin, the first being that of Ewers et al. (2010).

Table III
Antimicrobial susceptibility of ESBL-producing E. coli strains isolated from dogs
Antimicrobial 1062/09/D 1370/06/D 1945/06/D 2017/11/D
Amoxicillin R R R R
Amoxicillin/clavulanic acid R R R R
Cefuroxime R R R R
Cefotaxime R R R R
Cefovecin R R R R
Ciprofloxacin R R S R
Enrofloxacin R R S R
Marbofloxacin R R S R
Tetracycline R R R R
Gentamicin S S R R
Nitrofurantoin R R R R
Colistin S S R R
Florfenicol S S R R
Trimethoprim/Sulfamethoxazole S R R R
R – resistant, S – susceptible

In this study ESBL-producing E. coli strains were isolated from diseased dogs with extraintestinal infections. However, they have also been detected in faecal samples of healthy dogs and cats (Belas et al., 2014; Hordijk et al., 2013), and it seems that companion animals could be asymptomatic carriers of these bacteria.

The β-lactams are antimicrobial drugs commonly used in small animal veterinary practice (Murphy et al., 2012). The β-lactamases, which mediate the β-lactam resistance, are most often encoding by genes grouped in cassettes and located on mobile genetic elements, such as plasmids and transposons, so they may be extensively transmitted between different bacteria. Therefore inappropriate usage of β-lactams may contribute to the development of broad-spectrum resistance and to the dissemination of multiresistant strains among humans and animals. Our study showed that dogs in Poland can be a potential reservoir of ESBL-positive E. coli, though the prevalence of these bacteria in clinical specimen was relatively low.  The results suggest that the ESBL production is probably not a main mechanism of resistance to β-lactams in the studied E. coli population. However, the further investigation should explain a role of other resistance mechanisms in E. coli of canine origin.

Acknowledgements
The authors thank Barbara Chojnacka and Alicja Grzechnik for excellent technical assistance.

Literature

Belas A., A.S. Salazar, L.T. Gama, N. Couto and C. Pomba. 2014. Risk factors for faecal colonisation with Escherichia coli producing extended-spectrum and plasmid-mediated AmpC β-lactamases in dogs. Vet. Rec. 175:202.

Briñas L., M. Lantero, I. de Diego, M. Alvarez, M. Zarazaga, and C. Torres. 2005. Mechanisms of resistance to expanded-spectrum cephalosporins in Escherichia coli isolates recovered in a Spanish hospital. J. Antimicrob. Chemother. 56:1107-1110.

Carattoli A., S. Lovari, A. Franco, G. Cordaro, P. Di Matteo and A. Battisti. 2005. Extended-spectrum beta-lactamases in Escherichia coli isolated from dogs and cats in Rome, Italy, from 2001 to 2003. Antimicrob. Agents Chemother. 49:833-835.

CLSI. 2013. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated From Animals;Second Informational Supplement. CLSI document VET01-S2. Clinical and Laboratory Standards Institute, Wayne, PA.

Coque T.M., A. Oliver, J.C. Pérez-Díaz, F. Baquero and R. Cantón. 2002. Genes encoding TEM-4, SHV-2 and CTX-M-10 extended-spectrum β-Lactamases are carried by multiple Klebsiella pneumoniae clones in a single hospital (Madrid, 1989 to 2000). Antimicrob. Agents Chemother. 46:500-510.

Costa D., P. Poeta, Y. Sáenz, A.C. Coelho, M. Matos,  L. Vinué, J. Rodrigues and C. Torres. 2008. Prevalence of antimicrobial resistance and resistance genes in faecal Escherichia coli isolates recovered from healthy pets. Vet. Microbiol. 127:97-105.

Dhara L., A. Tripathi and A. Pal. 2013. Molecular characterization and in silico analysis of naturally occurring TEM beta-lactamase variants among pathogenic Enterobacteriaceae infecting Indian patients. Biomed Res Int. 2013: Article ID 783540.

Dierikx C.M., E. van Duijkeren, A.H. Schoormans, A. van Essen-Zandbergen, K. Veldman, A. Kant, X.W. Huijsdens, K. van der Zwaluw, J.A. Wagenaar and D.J. Mevius. 2012. Occurrence and characteristics of extended-spectrum-β-lactamase- and AmpC-producing clinical isolates derived from companion animals and horses. J. Antimicrob. Chemother. 67:1368-1374.

Ewers C., M. Grobbel, I. Stamm, P.A. Kopp, I. Diehl, T. Semmler, A. Fruth, J. Beutlich, B. Guerra, L.H. Wieler and others. 2010. Emergence of human pandemic O25:H4-ST131 CTX-M-15 extended-spectrum-beta-lactamase-producing Escherichia coli among companion animals. J. Antimicrob. Chemother. 65:651-660.

Hordijk J., A. Schoormans, M. Kwakernaak, B. Duim, E. Broens, C. Dierikx, D. Mevius and J.A. Wagenaar. 2013. High prevalence of fecal carriage of extended spectrum β-lactamase/AmpC-producing Enterobacteriaceae in cats and dogs. Front. Microbiol. 4:242.

Huber H., C. Zweifel, M.M. Wittenbrink and R. Stephan. 2013. ESBL-producing uropathogenic Escherichia coli isolated from dogs and cats in Switzerland. Vet. Microbiol. 162:992-996.

Murphy C.P.,  R.J. Reid-Smith, P. Boerlin, J.S. Weese, J.F. Prescott, N. Janecko and S.A. McEwen. 2012. Out-patient antimicrobial drug use in dogs and cats for new disease events from community companion animal practices in Ontario. Can. Vet. J. 53:291-298.

O’Keefe A., T.A. Hutton, D.M. Schifferli and S.C. Rankin. 2010. First detection of CTX-M and SHV extended-spectrum beta-lactamases in Escherichia coli urinary tract isolates from dogs and cats in the United States. Antimicrob. Agents Chemother. 54:3489-3492.

Rubin J.E. and J.D.D. Pitout. 2014. Extended-spectrum β-lactamase, carbapenemase and AmpC producing Enterobacteriaceae in companion animals. Vet. Microbiol. 170:10-18.

Rzewuska M, M. Czopowicz, M. Kizerwetter-Świda, D. Chrobak, B. Błaszczak and M. Binek. 2015. Multidrug resistance in Escherichia coli strains isolated from infections in dogs and cats in Poland (2007–2013) The Scientific World Journal 2015: Article ID 408205.

Schmiedel J., L. Falgenhauer, E. Domann, R. Bauerfeind, E. Prenger-Berninghoff, C. Imirzalioglu and T. Chakraborty. 2014. Multiresistant extended-spectrum β-lactamase-producing Enterobacteriaceae from humans, companion animals and horses in central Hesse, Germany. BMC Microbiol. 14:187.

Shaheen B.W., R. Nayak, S.L. Foley, O. Kweon, J. Deck, M. Park, F. Rafii and D.M. Boothe. 2011. Molecular characterization of resistance to extended-spectrum cephalosporins in clinical Escherichia coli isolates from companion animals in the United States. Antimicrob. Agents Chemother. 55:5666-5675.

So J.H., J. Kim, I.K. Bae, S.H. Jeong, S.H. Kim, S.K. Lim, Y.H. Park and K. Lee. 2012. Dissemination of multidrug-resistant Escherichia coli in Korean veterinary hospitals. Diagn. Microbiol. Infect. Dis. 73:195-199.

Thomson K.S. 2010. Extended-Spectrum-β-Lactamase, AmpC, and Carbapenemase Issues. J.  Clin. Microbiol. 48:1019-1025.